Transcript: Human XM_024448312.1

PREDICTED: Homo sapiens protein arginine methyltransferase 3 (PRMT3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRMT3 (10196)
Length:
2554
CDS:
528..1631

Additional Resources:

NCBI RefSeq record:
XM_024448312.1
NBCI Gene record:
PRMT3 (10196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034570 CCTTGTGGTATTAAGCATATA pLKO.1 1281 CDS 100% 13.200 18.480 N PRMT3 n/a
2 TRCN0000299321 CCTTGTGGTATTAAGCATATA pLKO_005 1281 CDS 100% 13.200 18.480 N PRMT3 n/a
3 TRCN0000379742 GACGTTTGCTCCACCAGATTT pLKO_005 1851 3UTR 100% 13.200 18.480 N PRMT3 n/a
4 TRCN0000034572 GCAGTGAGTGATGTGAATAAA pLKO.1 1140 CDS 100% 15.000 10.500 N PRMT3 n/a
5 TRCN0000299322 GCAGTGAGTGATGTGAATAAA pLKO_005 1140 CDS 100% 15.000 10.500 N PRMT3 n/a
6 TRCN0000034571 GCTGGCTACTTTGATATATAT pLKO.1 1389 CDS 100% 15.000 10.500 N PRMT3 n/a
7 TRCN0000034573 CGTGACCCTCACGTTGAATAA pLKO.1 1583 CDS 100% 13.200 9.240 N PRMT3 n/a
8 TRCN0000299323 CGTGACCCTCACGTTGAATAA pLKO_005 1583 CDS 100% 13.200 9.240 N PRMT3 n/a
9 TRCN0000380837 TGGTCTGCCACGTAATCATTT pLKO_005 1825 3UTR 100% 13.200 9.240 N PRMT3 n/a
10 TRCN0000034569 CCTTGGGAGAAAGAAGAGTAT pLKO.1 311 5UTR 100% 4.950 3.465 N PRMT3 n/a
11 TRCN0000299324 CCTTGGGAGAAAGAAGAGTAT pLKO_005 311 5UTR 100% 4.950 3.465 N PRMT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448312.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.