Transcript: Human XM_024448455.1

PREDICTED: Homo sapiens glutamate ionotropic receptor AMPA type subunit 4 (GRIA4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIA4 (2893)
Length:
2908
CDS:
980..2257

Additional Resources:

NCBI RefSeq record:
XM_024448455.1
NBCI Gene record:
GRIA4 (2893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412462 GTTGGCATGTCAGCGCTATAT pLKO_005 1512 CDS 100% 13.200 18.480 N GRIA4 n/a
2 TRCN0000430995 TATGGACGTAGAGTCAATTAC pLKO_005 2075 CDS 100% 13.200 18.480 N GRIA4 n/a
3 TRCN0000062984 CGCCTTACATATCTCCCTCAT pLKO.1 1312 CDS 100% 4.050 5.670 N GRIA4 n/a
4 TRCN0000062986 GCTGAAACTTTCCGAAGTCTT pLKO.1 1904 CDS 100% 4.950 3.960 N GRIA4 n/a
5 TRCN0000103039 AGTGGTTGTAACCACAATTAT pLKO.1 2227 CDS 100% 1.500 1.050 N Gria4 n/a
6 TRCN0000103038 CGCTGGAAGAAACTAGATCAA pLKO.1 1811 CDS 100% 4.950 6.930 N Gria4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.