Transcript: Human XM_024448469.1

PREDICTED: Homo sapiens ubiquilin 4 (UBQLN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBQLN4 (56893)
Length:
1823
CDS:
23..1720

Additional Resources:

NCBI RefSeq record:
XM_024448469.1
NBCI Gene record:
UBQLN4 (56893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434683 ATCTGATGCGTCACATGATTA pLKO_005 660 CDS 100% 13.200 18.480 N UBQLN4 n/a
2 TRCN0000435808 GATGTTCAATAGCCCAGAAAT pLKO_005 1150 CDS 100% 13.200 18.480 N UBQLN4 n/a
3 TRCN0000007739 GCGTCCATACTCTCTGGCTTT pLKO.1 488 CDS 100% 4.050 5.670 N UBQLN4 n/a
4 TRCN0000007740 CCCAAGGACAAGGAGGAAATT pLKO.1 80 CDS 100% 13.200 9.240 N UBQLN4 n/a
5 TRCN0000415289 GATCAGCCACATGCTCAATAA pLKO_005 724 CDS 100% 13.200 9.240 N UBQLN4 n/a
6 TRCN0000425809 AGGAAATCTCCCGGAGGTTTA pLKO_005 138 CDS 100% 10.800 7.560 N UBQLN4 n/a
7 TRCN0000011104 CGGGAACAGTTTGGCAACAAT pLKO.1 914 CDS 100% 5.625 3.938 N UBQLN4 n/a
8 TRCN0000007741 GCTGCTCAGATGATGGTGAAT pLKO.1 1280 CDS 100% 4.950 3.465 N UBQLN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.