Transcript: Human XM_024448471.1

PREDICTED: Homo sapiens doublecortin domain containing 1 (DCDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCDC1 (341019)
Length:
6026
CDS:
232..5592

Additional Resources:

NCBI RefSeq record:
XM_024448471.1
NBCI Gene record:
DCDC1 (341019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151323 GCTTCCAGTGAAATTCTAGAT pLKO.1 3508 CDS 100% 4.950 6.930 N n/a
2 TRCN0000149496 GCATGAGATTACAGTGGGAAA pLKO.1 1155 CDS 100% 4.050 5.670 N DCDC1 n/a
3 TRCN0000156402 CCGAACAGACTCAACAGGAAA pLKO.1 5081 CDS 100% 4.950 3.960 N n/a
4 TRCN0000158176 CCCAATCTTTACCTTGCGTGA pLKO.1 4611 CDS 100% 2.160 1.728 N n/a
5 TRCN0000129935 GTTGATGCTTCCTACTGATAT pLKO.1 1029 CDS 100% 13.200 9.240 N DCDC1 n/a
6 TRCN0000147677 GTTGCAGAGTTCTCTTCTTTA pLKO.1 667 CDS 100% 13.200 9.240 N DCDC1 n/a
7 TRCN0000151195 GAGATGAACTGGTGTATGTTT pLKO.1 3218 CDS 100% 5.625 3.938 N n/a
8 TRCN0000151292 CAGAGCAAATTATGCCAGAAT pLKO.1 5487 CDS 100% 4.950 3.465 N n/a
9 TRCN0000149392 GAACAGTCTTTGCCAGAGTTA pLKO.1 782 CDS 100% 4.950 3.465 N DCDC1 n/a
10 TRCN0000130384 GCACTATCTCAGTCTTCCTTA pLKO.1 265 CDS 100% 4.950 3.465 N DCDC1 n/a
11 TRCN0000155387 CCAATCTTTACCTTGCGTGAT pLKO.1 4612 CDS 100% 4.050 2.835 N n/a
12 TRCN0000149727 GTTTATGTCATCCCAGGCAAA pLKO.1 399 CDS 100% 4.050 2.835 N DCDC1 n/a
13 TRCN0000157434 GCTTACCCTCATCCTCAGAAA pLKO.1 4824 CDS 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.