Transcript: Human XM_024448504.1

PREDICTED: Homo sapiens inositol polyphosphate phosphatase like 1 (INPPL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPPL1 (3636)
Length:
4976
CDS:
306..4214

Additional Resources:

NCBI RefSeq record:
XM_024448504.1
NBCI Gene record:
INPPL1 (3636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052808 CCACCCAAGAACAGCTTCAAT pLKO.1 3363 CDS 100% 5.625 3.938 N INPPL1 n/a
2 TRCN0000311650 CCACCCAAGAACAGCTTCAAT pLKO_005 3363 CDS 100% 5.625 3.938 N INPPL1 n/a
3 TRCN0000052811 GACTACCTGAAAGGCAGCTAT pLKO.1 855 CDS 100% 4.950 3.465 N INPPL1 n/a
4 TRCN0000311647 GACTACCTGAAAGGCAGCTAT pLKO_005 855 CDS 100% 4.950 3.465 N INPPL1 n/a
5 TRCN0000052812 GCAGCTCAATGCCTTTGACAT pLKO.1 2069 CDS 100% 4.950 3.465 N INPPL1 n/a
6 TRCN0000052809 CCTGAACTACATCAGCAGGAA pLKO.1 2162 CDS 100% 2.640 1.848 N INPPL1 n/a
7 TRCN0000311648 CCTGAACTACATCAGCAGGAA pLKO_005 2162 CDS 100% 2.640 1.848 N INPPL1 n/a
8 TRCN0000052810 CCGGATTCTGTGGAAATCCTA pLKO.1 2375 CDS 100% 0.300 0.210 N INPPL1 n/a
9 TRCN0000311649 CCGGATTCTGTGGAAATCCTA pLKO_005 2375 CDS 100% 0.300 0.210 N INPPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.