Transcript: Human XM_024448571.1

PREDICTED: Homo sapiens hydroxysteroid 17-beta dehydrogenase 12 (HSD17B12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSD17B12 (51144)
Length:
2663
CDS:
578..1294

Additional Resources:

NCBI RefSeq record:
XM_024448571.1
NBCI Gene record:
HSD17B12 (51144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293197 GGATACTATCCGAGGTAATTT pLKO_005 1474 3UTR 100% 15.000 21.000 N HSD17B12 n/a
2 TRCN0000293257 GCTCTTATGGGCTCGATAATC pLKO_005 1181 CDS 100% 13.200 18.480 N HSD17B12 n/a
3 TRCN0000027140 CCGGAAGCCAACTTTGGATAA pLKO.1 1081 CDS 100% 10.800 15.120 N HSD17B12 n/a
4 TRCN0000027189 CGTGGGAATGTCGTATGAGTA pLKO.1 754 CDS 100% 4.950 6.930 N HSD17B12 n/a
5 TRCN0000298475 ATAGGAGCAAGGGCGTCTTTG pLKO_005 1014 CDS 100% 10.800 8.640 N HSD17B12 n/a
6 TRCN0000027145 CCTGCCTTCTTGGATTTATTT pLKO.1 1207 CDS 100% 15.000 10.500 N HSD17B12 n/a
7 TRCN0000293256 TCCCACTCTTGACCATCTATT pLKO_005 942 CDS 100% 13.200 9.240 N HSD17B12 n/a
8 TRCN0000027192 CGGGCTCACTATCTGAAGAAA pLKO.1 1259 CDS 100% 5.625 3.938 N HSD17B12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.