Transcript: Human XM_024449073.1

PREDICTED: Homo sapiens anoctamin 2 (ANO2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO2 (57101)
Length:
3973
CDS:
446..3325

Additional Resources:

NCBI RefSeq record:
XM_024449073.1
NBCI Gene record:
ANO2 (57101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135807 CAACAACACGATGGGTATTAA pLKO.1 1207 CDS 100% 15.000 21.000 N ANO2 n/a
2 TRCN0000138764 GCCAACAACACGATGGGTATT pLKO.1 1205 CDS 100% 10.800 15.120 N ANO2 n/a
3 TRCN0000136402 CGTCTATGTATTCGATGGTTA pLKO.1 2281 CDS 100% 4.950 6.930 N ANO2 n/a
4 TRCN0000135424 GCTACATCTCAGAAACTTCAA pLKO.1 3511 3UTR 100% 4.950 6.930 N ANO2 n/a
5 TRCN0000135279 CCTGAGTATGAAACCAAAGTT pLKO.1 1775 CDS 100% 5.625 3.938 N ANO2 n/a
6 TRCN0000135215 CTCGATGCAAAGAAGTTTGTT pLKO.1 2651 CDS 100% 5.625 3.938 N ANO2 n/a
7 TRCN0000138501 CCCAGGTTACCTGATGAACTT pLKO.1 1909 CDS 100% 4.950 3.465 N ANO2 n/a
8 TRCN0000137623 GAGGTTCAGTTCTGCAGGTTT pLKO.1 2933 CDS 100% 4.950 3.465 N ANO2 n/a
9 TRCN0000136813 CAACAACTATCTGGATGCCAA pLKO.1 541 CDS 100% 2.640 1.848 N ANO2 n/a
10 TRCN0000127012 CGATGGGTATTAACTCTCTAA pLKO.1 1215 CDS 100% 4.950 6.930 N Ano2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.