Transcript: Human XM_024449168.1

PREDICTED: Homo sapiens HNF1 homeobox A (HNF1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNF1A (6927)
Length:
4388
CDS:
1087..3075

Additional Resources:

NCBI RefSeq record:
XM_024449168.1
NBCI Gene record:
HNF1A (6927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017194 GTCCCTTAGTGACAGTGTCTA pLKO.1 2102 CDS 100% 4.950 6.930 N HNF1A n/a
2 TRCN0000017196 CACTCCCATGAAGACGCAGAA pLKO.1 1539 CDS 100% 4.050 5.670 N HNF1A n/a
3 TRCN0000017193 CCTTGTTCTGTCACCAATGTA pLKO.1 3525 3UTR 100% 5.625 3.938 N HNF1A n/a
4 TRCN0000416313 GTGTGGCGAAGATGGTCAAGT pLKO_005 1427 CDS 100% 4.950 3.465 N HNF1A n/a
5 TRCN0000421578 AGACTGCAGAAGTACCCTCAA pLKO_005 2072 CDS 100% 4.050 2.835 N HNF1A n/a
6 TRCN0000017195 GCTCCCGCAGACTATGCTCAT pLKO.1 2637 CDS 100% 1.350 0.945 N HNF1A n/a
7 TRCN0000017197 CCACAGCGTCATCGAGACCTT pLKO.1 3021 CDS 100% 0.880 0.616 N HNF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.