Transcript: Human XM_024449337.1

PREDICTED: Homo sapiens sacsin molecular chaperone (SACS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SACS (26278)
Length:
15715
CDS:
640..14406

Additional Resources:

NCBI RefSeq record:
XM_024449337.1
NBCI Gene record:
SACS (26278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369556 ATGTGTTGTAGCACGAATAAA pLKO_005 14439 3UTR 100% 15.000 21.000 N SACS n/a
2 TRCN0000084125 CCTCGATTATTGAGCAGTATA pLKO.1 12577 CDS 100% 13.200 18.480 N SACS n/a
3 TRCN0000291681 CCTCGATTATTGAGCAGTATA pLKO_005 12577 CDS 100% 13.200 18.480 N SACS n/a
4 TRCN0000303351 GATCCTCTTGGATGCGTTATT pLKO_005 14852 3UTR 100% 13.200 18.480 N SACS n/a
5 TRCN0000369621 GGCAATATTCAAGCGCATTAA pLKO_005 3438 CDS 100% 13.200 18.480 N SACS n/a
6 TRCN0000084124 CCGCTATGTAAGCATTGGAAA pLKO.1 10920 CDS 100% 4.950 6.930 N SACS n/a
7 TRCN0000291682 CCGCTATGTAAGCATTGGAAA pLKO_005 10920 CDS 100% 4.950 6.930 N SACS n/a
8 TRCN0000084127 CGTGCTACAATACAGCAGATA pLKO.1 5651 CDS 100% 4.950 3.960 N SACS n/a
9 TRCN0000303372 AGTTGACATCAGATCATATTT pLKO_005 4643 CDS 100% 15.000 10.500 N SACS n/a
10 TRCN0000084126 GCAAGATATTATTGCCAGATA pLKO.1 8012 CDS 100% 4.950 3.465 N SACS n/a
11 TRCN0000084123 GCTTCCTGTTTGATGAAGATA pLKO.1 15058 3UTR 100% 5.625 3.375 N SACS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.