Transcript: Human XM_024449364.1

PREDICTED: Homo sapiens LIM domain 7 (LMO7), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMO7 (4008)
Length:
5266
CDS:
727..4602

Additional Resources:

NCBI RefSeq record:
XM_024449364.1
NBCI Gene record:
LMO7 (4008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376396 AGTTGGGCAAGCCCGGTTTAT pLKO_005 895 CDS 100% 13.200 18.480 N LMO7 n/a
2 TRCN0000368960 CACAAAGCAACCCGTACTATA pLKO_005 410 5UTR 100% 13.200 18.480 N LMO7 n/a
3 TRCN0000368961 GAGAAGCTCTAAGACGTTTAA pLKO_005 1914 CDS 100% 13.200 18.480 N LMO7 n/a
4 TRCN0000364468 GTGACACAGATTCGGAATTTA pLKO_005 698 5UTR 100% 15.000 10.500 N LMO7 n/a
5 TRCN0000364469 AGAATTGGAGAGGCAACAAAT pLKO_005 3978 CDS 100% 13.200 9.240 N LMO7 n/a
6 TRCN0000368959 GTCTTGGTAGAACCAGTATTT pLKO_005 4687 3UTR 100% 13.200 9.240 N LMO7 n/a
7 TRCN0000006489 GCCTCTTTAGATTACATAGAA pLKO.1 4658 3UTR 100% 5.625 3.938 N LMO7 n/a
8 TRCN0000006492 GCTATTAACAACACCAAGTTT pLKO.1 2857 CDS 100% 5.625 3.938 N LMO7 n/a
9 TRCN0000006493 CCGGTTTATACAGAAGCAGAT pLKO.1 907 CDS 100% 4.050 2.835 N LMO7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.