Transcript: Human XM_024449677.1

PREDICTED: Homo sapiens ATP binding cassette subfamily D member 4 (ABCD4), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCD4 (5826)
Length:
2068
CDS:
232..1575

Additional Resources:

NCBI RefSeq record:
XM_024449677.1
NBCI Gene record:
ABCD4 (5826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059882 CACATGCAGATTCGGGTGAAT pLKO.1 430 CDS 100% 4.950 6.930 N ABCD4 n/a
2 TRCN0000286572 CACATGCAGATTCGGGTGAAT pLKO_005 430 CDS 100% 4.950 6.930 N ABCD4 n/a
3 TRCN0000298675 CTTCGGGAGCAGGTGATATAT pLKO_005 1162 CDS 100% 15.000 12.000 N Abcd4 n/a
4 TRCN0000298676 CTTCGGGAGCAGGTGATATAT pLKO_005 1162 CDS 100% 15.000 12.000 N ABCD4 n/a
5 TRCN0000059880 CCCAGGTTAGATCTGCAATTT pLKO.1 62 5UTR 100% 13.200 9.240 N ABCD4 n/a
6 TRCN0000293961 CTGATTACCTACAAATGATTT pLKO_005 1832 3UTR 100% 13.200 9.240 N ABCD4 n/a
7 TRCN0000298649 GTGAGCATCTTCGGGTATTTC pLKO_005 316 CDS 100% 13.200 9.240 N ABCD4 n/a
8 TRCN0000059879 CGGCATCAACACCTTTGACTA pLKO.1 570 CDS 100% 4.950 3.465 N ABCD4 n/a
9 TRCN0000286571 CGGCATCAACACCTTTGACTA pLKO_005 570 CDS 100% 4.950 3.465 N ABCD4 n/a
10 TRCN0000059881 CCTTGAGAAGTTTCATTCCTT pLKO.1 1497 CDS 100% 3.000 2.100 N ABCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.