Transcript: Human XM_024449735.1

PREDICTED: Homo sapiens stonin 2 (STON2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STON2 (85439)
Length:
4391
CDS:
328..3261

Additional Resources:

NCBI RefSeq record:
XM_024449735.1
NBCI Gene record:
STON2 (85439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111917 CGTCAGGAAGTGGGTCAATTA pLKO.1 3069 CDS 100% 13.200 18.480 N Ston2 n/a
2 TRCN0000065255 CCTCGTCAAAGGGAATGAAAT pLKO.1 2352 CDS 100% 13.200 10.560 N STON2 n/a
3 TRCN0000065254 GCTGGATATTTCCTCTTTAAA pLKO.1 1371 CDS 100% 15.000 10.500 N STON2 n/a
4 TRCN0000065257 CCTAGCTTTGGATGTTCGTAT pLKO.1 811 CDS 100% 4.950 3.465 N STON2 n/a
5 TRCN0000065256 GCATCTGTGATCCCAGATGTA pLKO.1 1273 CDS 100% 0.495 0.347 N STON2 n/a
6 TRCN0000065253 GCCAGTGTTGTCAATGGACTT pLKO.1 2154 CDS 100% 4.050 2.430 N STON2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.