Transcript: Human XM_024449754.1

PREDICTED: Homo sapiens A-kinase anchoring protein 6 (AKAP6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKAP6 (9472)
Length:
8827
CDS:
619..7581

Additional Resources:

NCBI RefSeq record:
XM_024449754.1
NBCI Gene record:
AKAP6 (9472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037914 CCTGGCTTGATGGACCTAAAT pLKO.1 4231 CDS 100% 13.200 18.480 N AKAP6 n/a
2 TRCN0000229378 TAAGTCCCTCTGTCGTGAAAT pLKO_005 3990 CDS 100% 13.200 18.480 N AKAP6 n/a
3 TRCN0000037915 CGGCATCTCTAACAGAACTTA pLKO.1 5675 CDS 100% 5.625 7.875 N AKAP6 n/a
4 TRCN0000037916 CGAAGATTGTTCAGTACACAA pLKO.1 6774 CDS 100% 4.950 6.930 N AKAP6 n/a
5 TRCN0000218838 ACCAACTGGTAGTCCATTAAA pLKO_005 7944 3UTR 100% 15.000 12.000 N AKAP6 n/a
6 TRCN0000037917 CCATCAGAGATTGCTTTAATT pLKO.1 1733 CDS 100% 15.000 10.500 N AKAP6 n/a
7 TRCN0000218046 GAGGCAAATGGTTGATCTAAA pLKO_005 1851 CDS 100% 13.200 9.240 N AKAP6 n/a
8 TRCN0000037918 GCAGAGATGGATGACCTTAAA pLKO.1 3046 CDS 100% 13.200 9.240 N AKAP6 n/a
9 TRCN0000229379 GGACATAAGTAACAAGTTAAT pLKO_005 4287 CDS 100% 13.200 9.240 N AKAP6 n/a
10 TRCN0000229377 GGCTTAACGACTGCTATAAAG pLKO_005 2069 CDS 100% 13.200 9.240 N AKAP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.