Transcript: Human XM_024449781.1

PREDICTED: Homo sapiens KIAA0586 (KIAA0586), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0586 (9786)
Length:
6260
CDS:
594..5363

Additional Resources:

NCBI RefSeq record:
XM_024449781.1
NBCI Gene record:
KIAA0586 (9786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127503 CAGTGTTTATGCCACTGGTTT pLKO.1 5384 3UTR 100% 0.495 0.693 N KIAA0586 n/a
2 TRCN0000431486 ATTATGTAGCTCAAGGTTATT pLKO_005 5673 3UTR 100% 13.200 10.560 N KIAA0586 n/a
3 TRCN0000421251 AGCTTACTGTGCAGGTATTAC pLKO_005 3145 CDS 100% 13.200 9.240 N KIAA0586 n/a
4 TRCN0000127673 CCTGTGATTCGGATCATGATA pLKO.1 3964 CDS 100% 5.625 3.938 N KIAA0586 n/a
5 TRCN0000130660 CCCTAATCTTGGTAGCTGTAA pLKO.1 1622 CDS 100% 4.950 3.465 N KIAA0586 n/a
6 TRCN0000127502 CGGCAATTTGACACAGTTTCA pLKO.1 4863 CDS 100% 4.950 3.465 N KIAA0586 n/a
7 TRCN0000127906 CTCTCTCAGACTGTTTGGTTT pLKO.1 5433 3UTR 100% 4.950 3.465 N KIAA0586 n/a
8 TRCN0000130759 GCAGAGTGATTTGGAAGCAAA pLKO.1 1304 CDS 100% 4.950 3.465 N KIAA0586 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.