Transcript: Human XM_024449818.1

PREDICTED: Homo sapiens ADAM metallopeptidase domain 10 (ADAM10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM10 (102)
Length:
4517
CDS:
340..2364

Additional Resources:

NCBI RefSeq record:
XM_024449818.1
NBCI Gene record:
ADAM10 (102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006676 GCAGTATTACTTATGGGAATT pLKO.1 2155 CDS 100% 0.000 0.000 N ADAM10 n/a
2 TRCN0000006672 CCAGGTGGAATTACTTAAATT pLKO.1 2507 3UTR 100% 15.000 10.500 N ADAM10 n/a
3 TRCN0000418144 GTTCATACTCCAAGTAGTAAT pLKO_005 2218 CDS 100% 13.200 9.240 N ADAM10 n/a
4 TRCN0000419446 TTGAATCTGGCCAACCTATTT pLKO_005 1475 CDS 100% 13.200 9.240 N ADAM10 n/a
5 TRCN0000006675 GCTGTGCAGATCATTCAGTAT pLKO.1 632 CDS 100% 4.950 3.465 N ADAM10 n/a
6 TRCN0000006674 CCCTACAAATCCTTTCCGTTT pLKO.1 972 CDS 100% 4.050 2.835 N ADAM10 n/a
7 TRCN0000031846 GAGTTATCAAATGGGACACAT pLKO.1 2334 CDS 100% 4.950 2.970 N Adam10 n/a
8 TRCN0000323715 GAGTTATCAAATGGGACACAT pLKO_005 2334 CDS 100% 4.950 2.970 N Adam10 n/a
9 TRCN0000006673 GCAGGTTCTATCTGTGAGAAA pLKO.1 1819 CDS 100% 4.950 2.970 N ADAM10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.