Transcript: Human XM_024450230.1

PREDICTED: Homo sapiens TOX high mobility group box family member 3 (TOX3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOX3 (27324)
Length:
4775
CDS:
260..1975

Additional Resources:

NCBI RefSeq record:
XM_024450230.1
NBCI Gene record:
TOX3 (27324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426734 TGTCTATTAGATAGGCAATAA pLKO_005 2107 3UTR 100% 13.200 18.480 N Tox3 n/a
2 TRCN0000237900 CCAACATGCCCTCGAACATTG pLKO_005 1458 CDS 100% 10.800 15.120 N TOX3 n/a
3 TRCN0000237899 GACACACAGGCTGCAATTAAA pLKO_005 1046 CDS 100% 15.000 10.500 N TOX3 n/a
4 TRCN0000237902 GACCACTGTTAGCCCATTATA pLKO_005 2650 3UTR 100% 15.000 10.500 N TOX3 n/a
5 TRCN0000237903 CAGACACAGACTCAAGTATTA pLKO_005 1934 CDS 100% 13.200 9.240 N TOX3 n/a
6 TRCN0000237901 GGGACATACTGATGACTATAA pLKO_005 2276 3UTR 100% 13.200 9.240 N TOX3 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 22 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 22 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.