Transcript: Human XM_024450276.1

PREDICTED: Homo sapiens zinc finger homeobox 3 (ZFHX3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFHX3 (463)
Length:
2222
CDS:
331..732

Additional Resources:

NCBI RefSeq record:
XM_024450276.1
NBCI Gene record:
ZFHX3 (463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163355 GATAGAGAAGCTGAGACACAA pLKO.1 360 CDS 100% 4.950 3.465 N n/a
2 TRCN0000164832 CCGTCTCTTAGACAAGCTGAA pLKO.1 1012 3UTR 100% 4.050 2.835 N n/a
3 TRCN0000163382 GAAGTTAACAAGAGCCAGCAA pLKO.1 382 CDS 100% 2.640 1.848 N n/a
4 TRCN0000161054 GCTAATTCATTTCAGGTGGAT pLKO.1 972 3UTR 100% 2.640 1.848 N n/a
5 TRCN0000162291 CAAAGAAGTTAACAAGAGCCA pLKO.1 378 CDS 100% 0.660 0.462 N n/a
6 TRCN0000161599 GCTGAGACACAAAGAAGTTAA pLKO.1 369 CDS 100% 13.200 7.920 N n/a
7 TRCN0000163442 GAGAAGCTGAGACACAAAGAA pLKO.1 364 CDS 100% 5.625 3.375 N n/a
8 TRCN0000159608 GAGACACAAAGAAGTTAACAA pLKO.1 372 CDS 100% 5.625 3.375 N n/a
9 TRCN0000166175 CCTGTCAGTTTCCTCCACATT pLKO.1 800 3UTR 100% 4.950 2.970 N n/a
10 TRCN0000163880 CAGCCATTCAGTTAAGTGGAA pLKO.1 708 CDS 100% 2.640 1.584 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.