Transcript: Human XM_024450444.1

PREDICTED: Homo sapiens immunoglobin superfamily member 21 (IGSF21), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGSF21 (84966)
Length:
1563
CDS:
162..1406

Additional Resources:

NCBI RefSeq record:
XM_024450444.1
NBCI Gene record:
IGSF21 (84966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232893 ACCAGCACCCATGGTTTATTT pLKO_005 530 CDS 100% 15.000 21.000 N IGSF21 n/a
2 TRCN0000232892 AGGTCCGGATCTCAGACAATG pLKO_005 316 CDS 100% 10.800 15.120 N IGSF21 n/a
3 TRCN0000180559 GATCTCAGACAATGGTCCCTA pLKO.1 323 CDS 100% 2.640 2.112 N IGSF21 n/a
4 TRCN0000232891 GCCGTGACTTTGAAGTGTAAC pLKO_005 123 5UTR 100% 10.800 7.560 N IGSF21 n/a
5 TRCN0000232890 GCTACCTGACAGTCAACATTG pLKO_005 73 5UTR 100% 10.800 7.560 N IGSF21 n/a
6 TRCN0000146596 CGTGACTTTGAAGTGTAACTT pLKO.1 125 5UTR 100% 5.625 3.938 N IGSF21 n/a
7 TRCN0000181040 CTCCACCAACTACTCACACAT pLKO.1 239 CDS 100% 4.950 3.465 N IGSF21 n/a
8 TRCN0000178821 CAACTACTCACACATGGAGAA pLKO.1 245 CDS 100% 4.050 2.835 N IGSF21 n/a
9 TRCN0000112604 TCAGGCAACATCTTCCTCAAT pLKO.1 399 CDS 100% 4.950 3.465 N Igsf21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.