Transcript: Human XM_024450493.1

PREDICTED: Homo sapiens short chain dehydrogenase/reductase family 42E, member 1 (SDR42E1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDR42E1 (93517)
Length:
2927
CDS:
290..1462

Additional Resources:

NCBI RefSeq record:
XM_024450493.1
NBCI Gene record:
SDR42E1 (93517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420713 GAGGGCAAGATATACTTATTT pLKO_005 1777 3UTR 100% 15.000 21.000 N SDR42E1 n/a
2 TRCN0000414238 TACTCTCGGACAAAGTCAATT pLKO_005 734 CDS 100% 13.200 18.480 N SDR42E1 n/a
3 TRCN0000028410 GCAACTCAATCGAAACCTGAT pLKO.1 544 CDS 100% 4.050 5.670 N SDR42E1 n/a
4 TRCN0000412489 GAAGCAGTGGAATGGTTTAAA pLKO_005 1313 CDS 100% 15.000 10.500 N SDR42E1 n/a
5 TRCN0000432328 TTGGTCTTCCTCCTGATTATA pLKO_005 1397 CDS 100% 15.000 10.500 N SDR42E1 n/a
6 TRCN0000028437 GCCAAGAAAGAGCTAGGTTAT pLKO.1 1268 CDS 100% 10.800 7.560 N SDR42E1 n/a
7 TRCN0000028405 CCATGTGATTCTGTTTGACAT pLKO.1 379 CDS 100% 4.950 3.465 N SDR42E1 n/a
8 TRCN0000028461 CCTGCCATTGACCTTGGTCTA pLKO.1 1123 CDS 100% 4.050 2.835 N SDR42E1 n/a
9 TRCN0000028458 CCTGCTCAAACCATTCCAGAA pLKO.1 407 CDS 100% 4.050 2.835 N SDR42E1 n/a
10 TRCN0000414405 CTCTTCAAATTGCTACTTAAG pLKO_005 1562 3UTR 100% 10.800 6.480 N SDR42E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.