Transcript: Human XM_024450571.1

PREDICTED: Homo sapiens ankyrin repeat domain 13B (ANKRD13B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD13B (124930)
Length:
3369
CDS:
428..1945

Additional Resources:

NCBI RefSeq record:
XM_024450571.1
NBCI Gene record:
ANKRD13B (124930)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122644 GCACACGGACAGAACATCTTT pLKO.1 888 CDS 100% 5.625 4.500 N ANKRD13B n/a
2 TRCN0000144569 GCTTCCCAGTTAAGATTGAAA pLKO.1 1305 CDS 100% 5.625 4.500 N ANKRD13B n/a
3 TRCN0000139696 CTAGCCTCTGTGGTTGTACAT pLKO.1 2796 3UTR 100% 4.950 3.960 N ANKRD13B n/a
4 TRCN0000431292 GGTATGAAGCTAAGGTGTATG pLKO_005 840 CDS 100% 10.800 7.560 N ANKRD13B n/a
5 TRCN0000140218 GCAAGGTCAAAGGCTGTAAGA pLKO.1 924 CDS 100% 4.950 3.465 N ANKRD13B n/a
6 TRCN0000442740 CCCGATCTTCCACATCCTCAA pLKO_005 1327 CDS 100% 4.050 2.835 N ANKRD13B n/a
7 TRCN0000145395 GAATATCTCCTTTGAGAGGAA pLKO.1 769 CDS 100% 2.640 1.848 N ANKRD13B n/a
8 TRCN0000143663 CAAAGGCTGTAAGACACCTTT pLKO.1 931 CDS 100% 0.495 0.347 N ANKRD13B n/a
9 TRCN0000121528 CGGACAGAACATCTTTCAGAA pLKO.1 893 CDS 100% 4.950 2.970 N ANKRD13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.