Transcript: Human XM_024450607.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 2 (DNAH2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH2 (146754)
Length:
13686
CDS:
83..13432

Additional Resources:

NCBI RefSeq record:
XM_024450607.1
NBCI Gene record:
DNAH2 (146754)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146535 GCCCTATTCAAAGAGCGTATT pLKO.1 2165 CDS 100% 10.800 15.120 N DNAH2 n/a
2 TRCN0000147695 GCTCTCAATGAGAGATATGAA pLKO.1 6094 CDS 100% 5.625 7.875 N DNAH2 n/a
3 TRCN0000131234 GCTTGTCTACTTCATTCGCCA pLKO.1 493 CDS 100% 0.660 0.924 N DNAH2 n/a
4 TRCN0000131125 GCCACAGATAACACGGAACTT pLKO.1 1333 CDS 100% 4.950 3.960 N DNAH2 n/a
5 TRCN0000148727 CCAGAGATACAACACACTGAT pLKO.1 12661 CDS 100% 4.950 3.465 N DNAH2 n/a
6 TRCN0000149627 GATGCCATTCTGGAACACTTT pLKO.1 377 CDS 100% 4.950 3.465 N DNAH2 n/a
7 TRCN0000148083 GCCACAAACTACTATTCAGTT pLKO.1 11124 CDS 100% 4.950 3.465 N DNAH2 n/a
8 TRCN0000148981 GCTAGAACTATCCAAGGCTAT pLKO.1 2614 CDS 100% 4.050 2.835 N DNAH2 n/a
9 TRCN0000146477 CTTGTCTACTTCATTCGCCAA pLKO.1 494 CDS 100% 2.160 1.512 N DNAH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.