Transcript: Human XM_024450668.1

PREDICTED: Homo sapiens exocyst complex component 7 (EXOC7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC7 (23265)
Length:
5004
CDS:
52..2343

Additional Resources:

NCBI RefSeq record:
XM_024450668.1
NBCI Gene record:
EXOC7 (23265)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135057 CCAAGATTTCATGAACGTCTA pLKO.1 687 CDS 100% 4.050 5.670 N EXOC7 n/a
2 TRCN0000278573 CCAAGATTTCATGAACGTCTA pLKO_005 687 CDS 100% 4.050 5.670 N EXOC7 n/a
3 TRCN0000134799 CCTGCACAACAACTACAATTA pLKO.1 1665 CDS 100% 13.200 9.240 N EXOC7 n/a
4 TRCN0000278566 CCTGCACAACAACTACAATTA pLKO_005 1665 CDS 100% 13.200 9.240 N EXOC7 n/a
5 TRCN0000377154 GAACCTTCTGAAACAGTATTC pLKO_005 879 CDS 100% 10.800 7.560 N Exoc7 n/a
6 TRCN0000134996 CACTAAGAACATGGTGTCTAT pLKO.1 165 CDS 100% 4.950 3.465 N EXOC7 n/a
7 TRCN0000137267 CGACCAGCTCACTAAGAACAT pLKO.1 156 CDS 100% 4.950 3.465 N EXOC7 n/a
8 TRCN0000278567 CGACCAGCTCACTAAGAACAT pLKO_005 156 CDS 100% 4.950 3.465 N EXOC7 n/a
9 TRCN0000136694 GAACCCGGAGAAGTACATCAA pLKO.1 2294 CDS 100% 4.950 3.465 N EXOC7 n/a
10 TRCN0000137284 GCTGCAGGAGAATGTTGAGAA pLKO.1 267 CDS 100% 4.950 3.465 N EXOC7 n/a
11 TRCN0000136114 GCAGATTATCAAGGAGCGTTT pLKO.1 2111 CDS 100% 4.050 2.835 N EXOC7 n/a
12 TRCN0000278513 GCAGATTATCAAGGAGCGTTT pLKO_005 2111 CDS 100% 4.050 2.835 N EXOC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.