Transcript: Human XM_024450739.1

PREDICTED: Homo sapiens forkhead box K2 (FOXK2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXK2 (3607)
Length:
4831
CDS:
562..1728

Additional Resources:

NCBI RefSeq record:
XM_024450739.1
NBCI Gene record:
FOXK2 (3607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274105 CTCACCCTGAACGGGATTTAT pLKO_005 580 CDS 100% 15.000 21.000 N FOXK2 n/a
2 TRCN0000016292 CGAGTTCGAGTATCTGATGAA pLKO.1 22 5UTR 100% 4.950 6.930 N FOXK2 n/a
3 TRCN0000016288 GCTGGCCTTAACACTCCTTAA pLKO.1 1861 3UTR 100% 10.800 8.640 N FOXK2 n/a
4 TRCN0000016291 CCAGCCTCTGAAAGCAAATTA pLKO.1 751 CDS 100% 15.000 10.500 N FOXK2 n/a
5 TRCN0000274042 CCAGCCTCTGAAAGCAAATTA pLKO_005 751 CDS 100% 15.000 10.500 N FOXK2 n/a
6 TRCN0000274103 TTACGATGGCTCCCGACAAAC pLKO_005 557 5UTR 100% 10.800 7.560 N FOXK2 n/a
7 TRCN0000016290 CCCGAGCACAAACATCAAGAT pLKO.1 328 5UTR 100% 4.950 3.465 N FOXK2 n/a
8 TRCN0000274104 CCCGAGCACAAACATCAAGAT pLKO_005 328 5UTR 100% 4.950 3.465 N FOXK2 n/a
9 TRCN0000274043 AGCGGAGACATGTGGAATTAG pLKO_005 2124 3UTR 100% 13.200 7.920 N FOXK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.