Transcript: Human XM_024451011.1

PREDICTED: Homo sapiens contactin associated protein 1 (CNTNAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTNAP1 (8506)
Length:
7747
CDS:
2510..6664

Additional Resources:

NCBI RefSeq record:
XM_024451011.1
NBCI Gene record:
CNTNAP1 (8506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434732 CATCAATATCACCCGTGTTTA pLKO_005 5944 CDS 100% 13.200 18.480 N CNTNAP1 n/a
2 TRCN0000422434 GCTGCTATGGCGATCGAAATT pLKO_005 4839 CDS 100% 13.200 18.480 N CNTNAP1 n/a
3 TRCN0000063143 CGAATCTAATTGCGGAGCTAT pLKO.1 6247 CDS 100% 4.950 6.930 N CNTNAP1 n/a
4 TRCN0000063146 CGTAATCTTCAACCGCGTCAA pLKO.1 3487 CDS 100% 4.050 5.670 N CNTNAP1 n/a
5 TRCN0000063144 CCACGATATTGGTGGTTTCTT pLKO.1 5497 CDS 100% 5.625 3.938 N CNTNAP1 n/a
6 TRCN0000063145 CCATTTGTAGTGTACTGTGAT pLKO.1 4337 CDS 100% 4.950 3.465 N CNTNAP1 n/a
7 TRCN0000063147 CCTCCTACTACAGTCTCCTTA pLKO.1 2631 CDS 100% 4.950 3.465 N CNTNAP1 n/a
8 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1504 5UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1374 5UTR 100% 2.640 1.320 Y LINC01098 n/a
10 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1269 5UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.