Transcript: Human XM_024451126.1

PREDICTED: Homo sapiens microtubule crosslinking factor 1 (MTCL1), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTCL1 (23255)
Length:
6934
CDS:
3611..6670

Additional Resources:

NCBI RefSeq record:
XM_024451126.1
NBCI Gene record:
MTCL1 (23255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173093 CCAAGTTTGAACGCACATGCT pLKO.1 5850 CDS 100% 2.640 3.696 N MTCL1 n/a
2 TRCN0000268610 TGCAAGCTTGCATGGATTATC pLKO_005 6631 CDS 100% 13.200 10.560 N MTCL1 n/a
3 TRCN0000268658 CCCGTGCACACCACCATTAAT pLKO_005 6014 CDS 100% 15.000 10.500 N MTCL1 n/a
4 TRCN0000167877 GCATGGATTATCACAGTATAA pLKO.1 6640 CDS 100% 13.200 9.240 N MTCL1 n/a
5 TRCN0000172930 GCTGCTGGAACATGCCTTAAA pLKO.1 6325 CDS 100% 13.200 9.240 N MTCL1 n/a
6 TRCN0000268657 GTCTGAGTTCCAGCGTCTAAT pLKO_005 4924 CDS 100% 13.200 9.240 N MTCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.