Transcript: Human XM_024451281.1

PREDICTED: Homo sapiens myomesin 1 (MYOM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYOM1 (8736)
Length:
5946
CDS:
335..5491

Additional Resources:

NCBI RefSeq record:
XM_024451281.1
NBCI Gene record:
MYOM1 (8736)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426645 GAGTCCTATTCTCGGATATTT pLKO_005 2047 CDS 100% 15.000 21.000 N MYOM1 n/a
2 TRCN0000160124 CCATTCATAGCATGAAGATTA pLKO.1 5700 3UTR 100% 13.200 18.480 N MYOM1 n/a
3 TRCN0000166530 CGGCAAGAATGGATCAGGAAA pLKO.1 4478 CDS 100% 4.950 6.930 N MYOM1 n/a
4 TRCN0000162579 CGTTCCTATATCTTCCGAGTT pLKO.1 2165 CDS 100% 4.050 5.670 N MYOM1 n/a
5 TRCN0000166437 CGGCTGAGAAAGCTAGACTTA pLKO.1 2253 CDS 100% 4.950 3.960 N MYOM1 n/a
6 TRCN0000420495 CTCAATGAGGCGGCTATTAAA pLKO_005 3701 CDS 100% 15.000 10.500 N MYOM1 n/a
7 TRCN0000159331 GCAGAAATTACTGGCTATTAT pLKO.1 3320 CDS 100% 15.000 10.500 N MYOM1 n/a
8 TRCN0000159451 GTCAGGTCTTTCACTCATATA pLKO.1 5612 3UTR 100% 13.200 9.240 N MYOM1 n/a
9 TRCN0000165689 CCCGAATGACAAAGGGAAGTA pLKO.1 4999 CDS 100% 4.950 3.465 N MYOM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.