Transcript: Human XM_024451866.1

PREDICTED: Homo sapiens cilia and flagella associated protein 61 (CFAP61), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP61 (26074)
Length:
3829
CDS:
1078..3525

Additional Resources:

NCBI RefSeq record:
XM_024451866.1
NBCI Gene record:
CFAP61 (26074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429184 GACGATCTCATGCCAATATTT pLKO_005 648 5UTR 100% 15.000 21.000 N CFAP61 n/a
2 TRCN0000423765 AGATTCTTCGAACCGTGTATA pLKO_005 430 5UTR 100% 13.200 18.480 N CFAP61 n/a
3 TRCN0000167812 GCTATGCTACATCTCTTTGAT pLKO.1 2836 CDS 100% 5.625 7.875 N CFAP61 n/a
4 TRCN0000168491 GCGCTATGACACAATTCTGAA pLKO.1 671 5UTR 100% 4.950 6.930 N CFAP61 n/a
5 TRCN0000434973 GTGGATTATGAAACGTTTAAA pLKO_005 2635 CDS 100% 15.000 12.000 N CFAP61 n/a
6 TRCN0000428360 ATACTTCCTGGCCGAACTAAT pLKO_005 707 5UTR 100% 13.200 10.560 N CFAP61 n/a
7 TRCN0000167878 GCTCTCACATGAAGTTTAATA pLKO.1 1871 CDS 100% 15.000 10.500 N CFAP61 n/a
8 TRCN0000416239 GGATTGCTCAAGTCCATTAAT pLKO_005 1264 CDS 100% 15.000 10.500 N CFAP61 n/a
9 TRCN0000168173 CGGTCCCATTACAACATTGAA pLKO.1 1417 CDS 100% 5.625 3.938 N CFAP61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.