Transcript: Human XM_024451961.1

PREDICTED: Homo sapiens engulfment and cell motility 2 (ELMO2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELMO2 (63916)
Length:
3438
CDS:
515..2128

Additional Resources:

NCBI RefSeq record:
XM_024451961.1
NBCI Gene record:
ELMO2 (63916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365344 GAAGCATCTCCGGTCTATAAT pLKO_005 745 CDS 100% 15.000 21.000 N ELMO2 n/a
2 TRCN0000365343 TACGCCATTGCACTGATTAAT pLKO_005 665 CDS 100% 15.000 21.000 N ELMO2 n/a
3 TRCN0000365412 GAGATGGCCCATCAGCTATAT pLKO_005 806 CDS 100% 13.200 18.480 N ELMO2 n/a
4 TRCN0000029064 CGGTCTATAATCCTGAATCAT pLKO.1 755 CDS 100% 5.625 7.875 N ELMO2 n/a
5 TRCN0000029065 GCTGGGATTTACCAACCACAT pLKO.1 1018 CDS 100% 4.050 5.670 N ELMO2 n/a
6 TRCN0000265757 TAACGCCCAGCTCCTTGAAAT pLKO_005 116 5UTR 100% 13.200 9.240 N Elmo2 n/a
7 TRCN0000370456 CTTGAAGTGACTACCTGTATC pLKO_005 2559 3UTR 100% 10.800 7.560 N ELMO2 n/a
8 TRCN0000370458 GAACTGAGGAGGATTGCATTT pLKO_005 917 CDS 100% 10.800 7.560 N ELMO2 n/a
9 TRCN0000029067 CCCTGATGAGACCTTAAACTT pLKO.1 1885 CDS 100% 5.625 3.938 N ELMO2 n/a
10 TRCN0000029066 GCATCCATTATCAAGGAAGTT pLKO.1 156 5UTR 100% 4.950 3.465 N ELMO2 n/a
11 TRCN0000029068 GCTCCTTGAAATCGACCAGAA pLKO.1 125 5UTR 100% 4.050 2.835 N ELMO2 n/a
12 TRCN0000112639 GCCTTCTCCATCCTGTATGAT pLKO.1 1865 CDS 100% 5.625 3.938 N Elmo2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.