Transcript: Human XM_024452014.1

PREDICTED: Homo sapiens KIAA1755 (KIAA1755), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1755 (85449)
Length:
2580
CDS:
273..2327

Additional Resources:

NCBI RefSeq record:
XM_024452014.1
NBCI Gene record:
KIAA1755 (85449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140821 GAGCAAGTATCCAGGACTCAT pLKO.1 998 CDS 100% 4.950 6.930 N KIAA1755 n/a
2 TRCN0000139365 CATGATCAAATGCCTCTCCCT pLKO.1 629 CDS 100% 0.660 0.528 N KIAA1755 n/a
3 TRCN0000144029 CAGGAGAAAGGTCAATCTTAA pLKO.1 1328 CDS 100% 13.200 9.240 N KIAA1755 n/a
4 TRCN0000139598 CTAAACCCAACCGAGCCAAAT pLKO.1 1789 CDS 100% 10.800 7.560 N KIAA1755 n/a
5 TRCN0000140025 GCTGAGCTTCCTTCTGGATTT pLKO.1 404 CDS 100% 10.800 7.560 N KIAA1755 n/a
6 TRCN0000139065 CAAGATAACCAGCCCAGAGTT pLKO.1 809 CDS 100% 4.950 3.465 N KIAA1755 n/a
7 TRCN0000140899 CCTCTAGGAAACCCAGAGAAT pLKO.1 1479 CDS 100% 4.950 3.465 N KIAA1755 n/a
8 TRCN0000145270 GAACTAAGGAAACTCCCTTAT pLKO.1 1201 CDS 100% 1.080 0.756 N KIAA1755 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.