Transcript: Human XM_024452082.1

PREDICTED: Homo sapiens pericentrin (PCNT), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCNT (5116)
Length:
9674
CDS:
305..9232

Additional Resources:

NCBI RefSeq record:
XM_024452082.1
NBCI Gene record:
PCNT (5116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161774 CGGCAGATAGACAAGTGTTAA pLKO.1 3876 CDS 100% 13.200 18.480 N PCNT n/a
2 TRCN0000278205 CGGCAGATAGACAAGTGTTAA pLKO_005 3876 CDS 100% 13.200 18.480 N PCNT n/a
3 TRCN0000163483 GCAGACTGTAGTGCGAGATTT pLKO.1 7027 CDS 100% 13.200 18.480 N PCNT n/a
4 TRCN0000297404 GCAGACTGTAGTGCGAGATTT pLKO_005 7027 CDS 100% 13.200 18.480 N PCNT n/a
5 TRCN0000162596 CGTAAAGAGATCACCGAGAAA pLKO.1 1811 CDS 100% 4.950 6.930 N PCNT n/a
6 TRCN0000278206 CGTAAAGAGATCACCGAGAAA pLKO_005 1811 CDS 100% 4.950 6.930 N PCNT n/a
7 TRCN0000159669 GCGACAATTCTATTTGAGGAA pLKO.1 9256 3UTR 100% 2.640 3.696 N PCNT n/a
8 TRCN0000160525 CGACAATTCTATTTGAGGAAA pLKO.1 9257 3UTR 100% 4.950 3.465 N PCNT n/a
9 TRCN0000162774 CGAGCAGACTTTGAGGAACAA pLKO.1 2168 CDS 100% 4.950 3.465 N PCNT n/a
10 TRCN0000162298 CGTGTCTAAGCTTGAGAAGTT pLKO.1 8437 CDS 100% 4.950 3.465 N PCNT n/a
11 TRCN0000297405 CGTGTCTAAGCTTGAGAAGTT pLKO_005 8437 CDS 100% 4.950 3.465 N PCNT n/a
12 TRCN0000159086 GAATTAAGTGTCCTCACCTTT pLKO.1 9367 3UTR 100% 4.950 3.465 N PCNT n/a
13 TRCN0000162995 GCAGCATGAAACTCGTCTGAA pLKO.1 1306 CDS 100% 4.950 3.465 N PCNT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.