Transcript: Human XM_024452302.1

PREDICTED: Homo sapiens LARGE xylosyl- and glucuronyltransferase 1 (LARGE1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LARGE1 (9215)
Length:
4390
CDS:
48..1994

Additional Resources:

NCBI RefSeq record:
XM_024452302.1
NBCI Gene record:
LARGE1 (9215)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034705 CTGGAGTATGACGGCAATCTT pLKO.1 1260 CDS 100% 5.625 7.875 N LARGE1 n/a
2 TRCN0000034704 CGTGGAGAAATGCGAGACAAT pLKO.1 440 CDS 100% 4.950 6.930 N LARGE1 n/a
3 TRCN0000034707 CCTTAGCTGACCAGGATATTT pLKO.1 1039 CDS 100% 15.000 10.500 N LARGE1 n/a
4 TRCN0000034708 CCACCTTATTGCTGACTCCAT pLKO.1 557 CDS 100% 2.640 1.848 N LARGE1 n/a
5 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 4120 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.