Transcript: Human XM_024452332.1

PREDICTED: Homo sapiens Kruppel like factor 8 (KLF8), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF8 (11279)
Length:
2112
CDS:
980..1666

Additional Resources:

NCBI RefSeq record:
XM_024452332.1
NBCI Gene record:
KLF8 (11279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015881 CCTCAGTCAGTCTGCCAAATA pLKO.1 1470 CDS 100% 13.200 9.240 N KLF8 n/a
2 TRCN0000015880 CCCAGCACTGTTTAATGACAT pLKO.1 1156 CDS 100% 4.950 3.465 N KLF8 n/a
3 TRCN0000015879 GCCATTACAGTCCCACTCATT pLKO.1 1577 CDS 100% 4.950 3.465 N KLF8 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1720 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.