Transcript: Human XM_024452404.1

PREDICTED: Homo sapiens muscleblind like splicing regulator 3 (MBNL3), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBNL3 (55796)
Length:
1549
CDS:
300..1076

Additional Resources:

NCBI RefSeq record:
XM_024452404.1
NBCI Gene record:
MBNL3 (55796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161368 GCGGAACAATCTGATTCAACA pLKO.1 263 5UTR 100% 4.950 6.930 N MBNL3 n/a
2 TRCN0000160794 CCATGATTGAAGCGAGTGATA pLKO.1 622 CDS 100% 4.950 3.960 N MBNL3 n/a
3 TRCN0000159465 CCAGCCAGCAAATTCAAATAA pLKO.1 1213 3UTR 100% 15.000 10.500 N MBNL3 n/a
4 TRCN0000160455 CATGATTGAAGCGAGTGATAA pLKO.1 623 CDS 100% 13.200 9.240 N MBNL3 n/a
5 TRCN0000160141 CCATCCATCCTATTTGAATTA pLKO.1 1296 3UTR 100% 13.200 9.240 N MBNL3 n/a
6 TRCN0000161082 GCCAGCCAGCAAATTCAAATA pLKO.1 1212 3UTR 100% 13.200 9.240 N MBNL3 n/a
7 TRCN0000159900 GCAGTCAATGTATTAAGCAAA pLKO.1 1183 3UTR 100% 4.950 3.465 N MBNL3 n/a
8 TRCN0000159756 GTTCAGATAAACTGGAGGTTT pLKO.1 529 CDS 100% 4.950 3.465 N MBNL3 n/a
9 TRCN0000164478 CCGCTTCAAATATTGTGCCCA pLKO.1 955 CDS 100% 0.660 0.462 N MBNL3 n/a
10 TRCN0000162715 CGGGAGAAATGCAAGTACTTT pLKO.1 687 CDS 100% 5.625 3.375 N MBNL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.