Transcript: Human XM_024452496.1

PREDICTED: Homo sapiens lysine demethylase 5D (KDM5D), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM5D (8284)
Length:
3487
CDS:
532..2907

Additional Resources:

NCBI RefSeq record:
XM_024452496.1
NBCI Gene record:
KDM5D (8284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234753 GAGAAGGCAGTGGCAACAATA pLKO_005 2258 CDS 100% 13.200 18.480 N KDM5D n/a
2 TRCN0000022115 GCCACATTGGAAGCCATAATT pLKO.1 1246 CDS 100% 15.000 12.000 N KDM5D n/a
3 TRCN0000234752 CCACATTGGAAGCCATAATTC pLKO_005 1247 CDS 100% 13.200 10.560 N KDM5D n/a
4 TRCN0000359116 GCCGAGAAGAAGAACATTATC pLKO_005 2717 CDS 100% 13.200 9.240 N KDM5D n/a
5 TRCN0000359115 GCTAGCATACAGGAGTGATTT pLKO_005 3119 3UTR 100% 13.200 9.240 N KDM5D n/a
6 TRCN0000234754 AGTGGCACCAAAGGTCATTTG pLKO_005 2909 3UTR 100% 10.800 7.560 N KDM5D n/a
7 TRCN0000022118 CAGCCCTTTCTTGAAAGGAAA pLKO.1 2787 CDS 100% 0.495 0.297 N KDM5D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.