Transcript: Human XM_024452565.1

PREDICTED: Homo sapiens RAB10, member RAS oncogene family (RAB10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB10 (10890)
Length:
2914
CDS:
168..524

Additional Resources:

NCBI RefSeq record:
XM_024452565.1
NBCI Gene record:
RAB10 (10890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029191 CCTCACGTTAGCTGAAGATAT pLKO.1 410 CDS 100% 13.200 18.480 N RAB10 n/a
2 TRCN0000381036 TTGCAAGGGAGCATGGTATTA pLKO_005 340 CDS 100% 13.200 10.560 N RAB10 n/a
3 TRCN0000380442 ACTAGGAAACAAGTGTGATAT pLKO_005 278 CDS 100% 13.200 9.240 N RAB10 n/a
4 TRCN0000382083 GTCCAGTTCTTATCAACATTA pLKO_005 796 3UTR 100% 13.200 9.240 N RAB10 n/a
5 TRCN0000379769 GCAATCATTTCAAATCTATTC pLKO_005 826 3UTR 100% 10.800 7.560 N RAB10 n/a
6 TRCN0000029190 CCAATGAAGATGTGGAAAGAA pLKO.1 253 CDS 100% 5.625 3.938 N RAB10 n/a
7 TRCN0000029192 GCAATGGGTATCATGCTAGTA pLKO.1 165 5UTR 100% 4.950 3.465 N RAB10 n/a
8 TRCN0000029193 CAAGTGTGATATGGACGACAA pLKO.1 287 CDS 100% 4.050 2.835 N RAB10 n/a
9 TRCN0000100839 CATGCCAATGAAGATGTGGAA pLKO.1 249 CDS 100% 2.640 1.848 N Rab10 n/a
10 TRCN0000382510 AGAAGATCAAGCTACAGATAT pLKO_005 88 5UTR 100% 13.200 7.920 N RAB10 n/a
11 TRCN0000382193 GAAGATCAAGCTACAGATATG pLKO_005 89 5UTR 100% 10.800 6.480 N Rab10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.