Transcript: Human XM_024452689.1

PREDICTED: Homo sapiens chromosome 2 open reading frame 73 (C2orf73), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C2orf73 (129852)
Length:
1221
CDS:
130..735

Additional Resources:

NCBI RefSeq record:
XM_024452689.1
NBCI Gene record:
C2orf73 (129852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142692 CAGGAGCTGTTAGAGCCTAAA pLKO.1 872 3UTR 100% 10.800 8.640 N C2orf73 n/a
2 TRCN0000121716 CCCTGGAATATAGGGAAATTT pLKO.1 1079 3UTR 100% 15.000 10.500 N C2orf73 n/a
3 TRCN0000141292 CAGTAGGCCAACAGTTCCTAA pLKO.1 730 CDS 100% 4.950 3.465 N C2orf73 n/a
4 TRCN0000143273 GCAGAGGTATTACTGAACACT pLKO.1 755 3UTR 100% 3.000 2.100 N C2orf73 n/a
5 TRCN0000122789 GAGAAAGGAAACTCAGCGGAA pLKO.1 812 3UTR 100% 2.160 1.512 N C2orf73 n/a
6 TRCN0000141127 CAGAATGATCTCACCAGGTCT pLKO.1 835 3UTR 100% 2.640 1.584 N C2orf73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.