Transcript: Human XM_024452764.1

PREDICTED: Homo sapiens centrosomal protein 68 (CEP68), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP68 (23177)
Length:
3026
CDS:
170..2308

Additional Resources:

NCBI RefSeq record:
XM_024452764.1
NBCI Gene record:
CEP68 (23177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128696 CTATAGGCAAGCACCTTGATA pLKO.1 1446 CDS 100% 5.625 7.875 N CEP68 n/a
2 TRCN0000130399 GCTTGACTATACTTACCCACT pLKO.1 1075 CDS 100% 2.160 3.024 N CEP68 n/a
3 TRCN0000338784 GCTTGACTATACTTACCCACT pLKO_005 1075 CDS 100% 2.160 3.024 N CEP68 n/a
4 TRCN0000129429 GCACCCTCAAATCACCTACTA pLKO.1 1203 CDS 100% 4.950 3.960 N CEP68 n/a
5 TRCN0000350995 ACCCTCAAATCACCTACTAAT pLKO_005 1205 CDS 100% 13.200 9.240 N CEP68 n/a
6 TRCN0000129360 GCTGATCTGCTGGCTGTATAA pLKO.1 2077 CDS 100% 13.200 9.240 N CEP68 n/a
7 TRCN0000338716 TTTCGTATCTAGGATCCATTT pLKO_005 1656 CDS 100% 10.800 7.560 N CEP68 n/a
8 TRCN0000129062 GAAGAGGAAGTGGAAAGTGAT pLKO.1 1586 CDS 100% 4.950 3.465 N CEP68 n/a
9 TRCN0000129139 GATGCTGATACCGAAGATGAT pLKO.1 611 CDS 100% 4.950 3.465 N CEP68 n/a
10 TRCN0000338722 GATGCTGATACCGAAGATGAT pLKO_005 611 CDS 100% 4.950 3.465 N CEP68 n/a
11 TRCN0000128481 GAAAGTGATGACGAGTATCTT pLKO.1 1598 CDS 100% 5.625 3.375 N CEP68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.