Transcript: Human XM_024452773.1

PREDICTED: Homo sapiens pumilio RNA binding family member 2 (PUM2), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PUM2 (23369)
Length:
5030
CDS:
349..2160

Additional Resources:

NCBI RefSeq record:
XM_024452773.1
NBCI Gene record:
PUM2 (23369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061861 GCTCCCAGAGTAGTTCTTTAT pLKO.1 554 CDS 100% 13.200 10.560 N PUM2 n/a
2 TRCN0000291397 GCTCCCAGAGTAGTTCTTTAT pLKO_005 554 CDS 100% 13.200 10.560 N PUM2 n/a
3 TRCN0000233379 CTAGCTCCAACTGCCTATTAT pLKO_005 262 5UTR 100% 15.000 10.500 N Pum2 n/a
4 TRCN0000297020 CTAGCTCCAACTGCCTATTAT pLKO_005 262 5UTR 100% 15.000 10.500 N PUM2 n/a
5 TRCN0000296921 CATTACTACTTTGCGCAAATA pLKO_005 2040 CDS 100% 13.200 9.240 N PUM2 n/a
6 TRCN0000061862 CGTGGTCATGTTCTACCCTTA pLKO.1 1357 CDS 100% 4.050 2.835 N PUM2 n/a
7 TRCN0000061858 GCCGCGTTATTCAGAAAGCAT pLKO.1 1397 CDS 100% 3.000 2.100 N PUM2 n/a
8 TRCN0000296986 TTGACTTTATTCATCCATTTG pLKO_005 2281 3UTR 100% 10.800 6.480 N PUM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.