Transcript: Human XM_024453010.1

PREDICTED: Homo sapiens tripartite motif containing 54 (TRIM54), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM54 (57159)
Length:
1956
CDS:
304..1380

Additional Resources:

NCBI RefSeq record:
XM_024453010.1
NBCI Gene record:
TRIM54 (57159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419353 CGGAGGCAGAAGCAGTTGTTA pLKO_005 922 CDS 100% 5.625 7.875 N TRIM54 n/a
2 TRCN0000200389 GCTATGAGAGCATGGAGCAAT pLKO.1 1217 CDS 100% 4.950 6.930 N Trim54 n/a
3 TRCN0000033889 GCCAGACTATCGAGGACAATA pLKO.1 899 CDS 100% 13.200 10.560 N TRIM54 n/a
4 TRCN0000424451 CAAATGTGCCAACGACGTCTT pLKO_005 447 CDS 100% 4.050 2.835 N TRIM54 n/a
5 TRCN0000033892 CACCATTTACAAACGCCAGAA pLKO.1 795 CDS 100% 4.050 2.835 N TRIM54 n/a
6 TRCN0000217139 CACCATTTACAAACGCCAGAA pLKO.1 795 CDS 100% 4.050 2.835 N Trim54 n/a
7 TRCN0000033890 GCATGGAGCAATTCACCGTAA pLKO.1 1226 CDS 100% 4.050 2.835 N TRIM54 n/a
8 TRCN0000033893 GTTCTCCAAACCAGTGGTGAT pLKO.1 399 CDS 100% 4.050 2.835 N TRIM54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.