Transcript: Human XM_024453100.1

PREDICTED: Homo sapiens titin (TTN), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTN (7273)
Length:
71774
CDS:
27..70751

Additional Resources:

NCBI RefSeq record:
XM_024453100.1
NBCI Gene record:
TTN (7273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246184 AGCCGGATTAACGGTTATAAA pLKO_005 70966 3UTR 100% 15.000 21.000 N TTN n/a
2 TRCN0000246183 CCGTAATACAGCTACAATTAA pLKO_005 46403 CDS 100% 15.000 21.000 N TTN n/a
3 TRCN0000195325 CCGTGTGTATGCCGTTAATAA pLKO.1 29465 CDS 100% 15.000 21.000 N TTN n/a
4 TRCN0000246182 GACGTCCCTGGACCTATTATA pLKO_005 39255 CDS 100% 15.000 21.000 N TTN n/a
5 TRCN0000246186 GTTCCGTGTTACAGCTATAAA pLKO_005 29156 CDS 100% 15.000 21.000 N TTN n/a
6 TRCN0000037481 CGCTGGATTAAATGCAACAAA pLKO.1 35577 CDS 100% 5.625 7.875 N TTN n/a
7 TRCN0000246185 TCCGTGTGTATGCCGTTAATA pLKO_005 29464 CDS 100% 15.000 10.500 N TTN n/a
8 TRCN0000194712 CAACACTTTGTTCGCTCATTT pLKO.1 71361 3UTR 100% 13.200 9.240 N TTN n/a
9 TRCN0000194767 CCTTATACTCTACACTCATTC pLKO.1 70764 3UTR 100% 10.800 7.560 N TTN n/a
10 TRCN0000037479 CGCCCAATAAAGGACTTGAAA pLKO.1 13488 CDS 100% 5.625 3.938 N TTN n/a
11 TRCN0000196828 GCTGTGCATATCACTTGATAT pLKO.1 71190 3UTR 100% 1.320 0.924 N TTN n/a
12 TRCN0000037480 GCCCAGAATAAATATGGCATT pLKO.1 19356 CDS 100% 4.050 2.430 N TTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.