Transcript: Human XM_024453298.1

PREDICTED: Homo sapiens NME/NM23 nucleoside diphosphate kinase 6 (NME6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NME6 (10201)
Length:
2965
CDS:
1086..2096

Additional Resources:

NCBI RefSeq record:
XM_024453298.1
NBCI Gene record:
NME6 (10201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010191 CCAATCCGAGCCTACATCCTT pLKO.1 1557 CDS 100% 3.000 4.200 N NME6 n/a
2 TRCN0000344507 CCAATCCGAGCCTACATCCTT pLKO_005 1557 CDS 100% 3.000 4.200 N NME6 n/a
3 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2101 3UTR 100% 4.950 2.475 Y ORAI2 n/a
4 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2091 CDS 100% 13.200 6.600 Y IQCC n/a
5 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2098 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.