Transcript: Human XM_024453429.1

PREDICTED: Homo sapiens VPS8 subunit of CORVET complex (VPS8), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS8 (23355)
Length:
6111
CDS:
2964..5531

Additional Resources:

NCBI RefSeq record:
XM_024453429.1
NBCI Gene record:
VPS8 (23355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381932 GGAGTGCCTTGAGCCATATAT pLKO_005 3092 CDS 100% 15.000 21.000 N Vps8 n/a
2 TRCN0000426943 GTAGGTGGAACTCACACAAAT pLKO_005 5859 3UTR 100% 13.200 18.480 N VPS8 n/a
3 TRCN0000382256 TTCAACCCAACCCAAGTTATA pLKO_005 4359 CDS 100% 13.200 18.480 N VPS8 n/a
4 TRCN0000416748 CATTTCGCCTATTGCGACTTT pLKO_005 5813 3UTR 100% 4.950 6.930 N VPS8 n/a
5 TRCN0000116188 CCCTCATTGAAGGATGTTGAA pLKO.1 4575 CDS 100% 4.950 6.930 N VPS8 n/a
6 TRCN0000116187 CGTCAGTTCACCAGACTCATT pLKO.1 5729 3UTR 100% 4.950 6.930 N VPS8 n/a
7 TRCN0000380563 CAAGATGGACATGCTACAAAT pLKO_005 5149 CDS 100% 13.200 9.240 N VPS8 n/a
8 TRCN0000381468 GGTGCCTGTCATAGTTGATTA pLKO_005 2984 CDS 100% 13.200 9.240 N VPS8 n/a
9 TRCN0000380986 TGGTGACAGGACCAACTTAAA pLKO_005 470 5UTR 100% 13.200 9.240 N VPS8 n/a
10 TRCN0000382144 TTCACTTCATGGATCAGTTAT pLKO_005 518 5UTR 100% 13.200 9.240 N VPS8 n/a
11 TRCN0000382224 CAAGATCTCCATTGGTCATTG pLKO_005 4944 CDS 100% 10.800 7.560 N VPS8 n/a
12 TRCN0000116189 CCATCGTATCATCAGTCCAAA pLKO.1 5259 CDS 100% 4.950 3.465 N VPS8 n/a
13 TRCN0000084545 CGCCAAGAAATGGCTGATGAA pLKO.1 5046 CDS 100% 4.950 3.465 N Vps8 n/a
14 TRCN0000116190 CCAAACAAGATTACTGCTCTA pLKO.1 5002 CDS 100% 4.050 2.835 N VPS8 n/a
15 TRCN0000116191 CCTCATCAACTTTACCTGGAT pLKO.1 2300 5UTR 100% 2.640 1.848 N VPS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.