Transcript: Human XM_024453616.1

PREDICTED: Homo sapiens anoctamin 10 (ANO10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO10 (55129)
Length:
2123
CDS:
117..2108

Additional Resources:

NCBI RefSeq record:
XM_024453616.1
NBCI Gene record:
ANO10 (55129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454987 CAAGAGACAGTTGCGCATTTA pLKO_005 1040 CDS 100% 13.200 18.480 N ANO10 n/a
2 TRCN0000416701 ATGAATCGTCTCTATCGATAT pLKO_005 1233 CDS 100% 10.800 15.120 N ANO10 n/a
3 TRCN0000428199 ATGGTGTCTTGGGTATCAATT pLKO_005 982 CDS 100% 13.200 9.240 N ANO10 n/a
4 TRCN0000145352 GCAGACATTGATGCTACATTA pLKO.1 1530 CDS 100% 13.200 9.240 N ANO10 n/a
5 TRCN0000417218 TCACTAACTGTGCGCTGATTG pLKO_005 1936 CDS 100% 10.800 7.560 N ANO10 n/a
6 TRCN0000143058 CACATACAGAACCAGACAGAA pLKO.1 416 CDS 100% 4.950 3.465 N ANO10 n/a
7 TRCN0000415319 TCACACCTTTGGTGGTCATAG pLKO_005 160 CDS 100% 10.800 6.480 N ANO10 n/a
8 TRCN0000145582 CCTTTGATGATTACTTGGAGT pLKO.1 1597 CDS 100% 2.640 1.584 N ANO10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.