Transcript: Human XM_024453831.1

PREDICTED: Homo sapiens coatomer protein complex subunit beta 2 (COPB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COPB2 (9276)
Length:
4924
CDS:
698..2656

Additional Resources:

NCBI RefSeq record:
XM_024453831.1
NBCI Gene record:
COPB2 (9276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065115 GCCCACGATTCTTCAGAGTAT pLKO.1 1124 CDS 100% 4.950 6.930 N COPB2 n/a
2 TRCN0000286527 GCCCACGATTCTTCAGAGTAT pLKO_005 1124 CDS 100% 4.950 6.930 N COPB2 n/a
3 TRCN0000065117 GCAGATTAGAGTGTTCAATTA pLKO.1 315 5UTR 100% 13.200 10.560 N COPB2 n/a
4 TRCN0000286459 GCAGATTAGAGTGTTCAATTA pLKO_005 315 5UTR 100% 13.200 10.560 N COPB2 n/a
5 TRCN0000065116 CCAGCCAAACAATACCCACTT pLKO.1 2393 CDS 100% 4.050 3.240 N COPB2 n/a
6 TRCN0000382223 ATCCTGAGTTGCCAATCATTA pLKO_005 791 CDS 100% 13.200 9.240 N COPB2 n/a
7 TRCN0000293894 ATTGCTACTGAGGAATCATTT pLKO_005 1370 CDS 100% 13.200 9.240 N COPB2 n/a
8 TRCN0000293939 CCTGACTAAACAGATCATTAT pLKO_005 2676 3UTR 100% 13.200 9.240 N COPB2 n/a
9 TRCN0000293938 TGCTAGATCTGATCGAGTTAA pLKO_005 114 5UTR 100% 13.200 9.240 N COPB2 n/a
10 TRCN0000381886 TTGAAGGACACACCCATTATG pLKO_005 491 5UTR 100% 13.200 9.240 N COPB2 n/a
11 TRCN0000113176 CCCAAAGATAACAATCAGTTT pLKO.1 532 5UTR 100% 4.950 3.465 N Copb2 n/a
12 TRCN0000065114 CCTCAGACTATTCAGCACAAT pLKO.1 998 CDS 100% 4.950 3.465 N COPB2 n/a
13 TRCN0000065113 GCCATTAGTAAATGTCAGTTT pLKO.1 1964 CDS 100% 4.950 3.465 N COPB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.