Transcript: Human XM_024454296.1

PREDICTED: Homo sapiens neurofascin (NFASC), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NFASC (23114)
Length:
10519
CDS:
67..4236

Additional Resources:

NCBI RefSeq record:
XM_024454296.1
NBCI Gene record:
NFASC (23114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155083 GACACGAAACAGCAGATTCTT pLKO.1 738 CDS 100% 5.625 7.875 N NFASC n/a
2 TRCN0000155244 GCCATCGAAATTCCTATGGAT pLKO.1 583 CDS 100% 3.000 4.200 N NFASC n/a
3 TRCN0000157793 CGGAGACCTATACTTCTCCAA pLKO.1 1095 CDS 100% 0.264 0.370 N NFASC n/a
4 TRCN0000155494 CCATCTGATAAGGCCAAGTTT pLKO.1 1375 CDS 100% 5.625 4.500 N NFASC n/a
5 TRCN0000094172 CGATGGTTTAAGAATGGGCAA pLKO.1 1900 CDS 100% 2.160 1.728 N Nfasc n/a
6 TRCN0000156784 GCAGACCGACTACAGTTGTAA pLKO.1 1134 CDS 100% 5.625 3.938 N NFASC n/a
7 TRCN0000157822 CCAAGACAAACGTGTCTCTCA pLKO.1 1065 CDS 100% 0.264 0.185 N NFASC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.