Transcript: Mouse XM_030242637.1

PREDICTED: Mus musculus phosphatidylserine synthase 2 (Ptdss2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ptdss2 (27388)
Length:
2086
CDS:
588..1448

Additional Resources:

NCBI RefSeq record:
XM_030242637.1
NBCI Gene record:
Ptdss2 (27388)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030242637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313861 TACGACTTCATGGATGAATTG pLKO_005 1056 CDS 100% 10.800 15.120 N Ptdss2 n/a
2 TRCN0000075810 CGATGGCACTAACACCTTCTT pLKO.1 228 5UTR 100% 4.950 6.930 N Ptdss2 n/a
3 TRCN0000317384 CGATGGCACTAACACCTTCTT pLKO_005 228 5UTR 100% 4.950 6.930 N Ptdss2 n/a
4 TRCN0000045799 GCGTGAGATCTACGACTTCAT pLKO.1 1046 CDS 100% 4.950 6.930 N PTDSS2 n/a
5 TRCN0000075811 CTACGACTTCATGGATGAATT pLKO.1 1055 CDS 100% 0.000 0.000 N Ptdss2 n/a
6 TRCN0000075812 GCTGTCCCTGAAGACATATAA pLKO.1 761 CDS 100% 15.000 10.500 N Ptdss2 n/a
7 TRCN0000313794 CTGTCCCTGAAGACATATAAG pLKO_005 762 CDS 100% 13.200 9.240 N Ptdss2 n/a
8 TRCN0000075808 CGGTACTCTTTCTCCACTCTT pLKO.1 1759 3UTR 100% 4.950 3.465 N Ptdss2 n/a
9 TRCN0000317451 CGGTACTCTTTCTCCACTCTT pLKO_005 1759 3UTR 100% 4.950 3.465 N Ptdss2 n/a
10 TRCN0000075809 GCACACTTCATTGGCTGGTAT pLKO.1 513 5UTR 100% 4.950 3.465 N Ptdss2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030242637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.