Transcript: Mouse XM_030244077.1

PREDICTED: Mus musculus FYVE and coiled-coil domain containing 1 (Fyco1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fyco1 (17281)
Length:
8046
CDS:
562..4875

Additional Resources:

NCBI RefSeq record:
XM_030244077.1
NBCI Gene record:
Fyco1 (17281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030244077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184601 GCCAAGGTGAAAGGAGCAAAT pLKO.1 796 CDS 100% 10.800 7.560 N Fyco1 n/a
2 TRCN0000179990 CCCTGCAACCTTTCTATGAAA pLKO.1 5997 3UTR 100% 5.625 3.938 N Fyco1 n/a
3 TRCN0000178746 CGGGAAGAACAGGTAAACAAT pLKO.1 2263 CDS 100% 5.625 3.938 N Fyco1 n/a
4 TRCN0000038916 CATCTCCTTCAGTGTGGTCTT pLKO.1 4632 CDS 100% 4.050 2.835 N FYCO1 n/a
5 TRCN0000183006 CCTGAATTGTTCTCTAAACAA pLKO.1 1218 CDS 100% 0.563 0.394 N Fyco1 n/a
6 TRCN0000183567 GCAACCTTTCTATGAAAGAAA pLKO.1 6001 3UTR 100% 0.563 0.394 N Fyco1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5605 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030244077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.