Transcript: Mouse XM_030252070.1

PREDICTED: Mus musculus nuclear receptor coactivator 2 (Ncoa2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ncoa2 (17978)
Length:
4967
CDS:
213..4766

Additional Resources:

NCBI RefSeq record:
XM_030252070.1
NBCI Gene record:
Ncoa2 (17978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030252070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238243 ATATTGGTTTACCGGAAATAA pLKO_005 2479 CDS 100% 15.000 21.000 N Ncoa2 n/a
2 TRCN0000096173 CTGCGCTATTTGCTCGACAAA pLKO.1 2445 CDS 100% 4.950 6.930 N Ncoa2 n/a
3 TRCN0000238246 GCCCACTCAGGCTCCTATTAA pLKO_005 3899 CDS 100% 15.000 10.500 N Ncoa2 n/a
4 TRCN0000244224 ATCCGTTCTCAGACTACTAAT pLKO_005 1278 CDS 100% 13.200 9.240 N Ncoa2 n/a
5 TRCN0000276447 ATCCGTTCTCAGACTACTAAT pLKO_005 1278 CDS 100% 13.200 9.240 N NCOA2 n/a
6 TRCN0000238244 CATGACCCTCGGTAGCAATAT pLKO_005 1460 CDS 100% 13.200 9.240 N Ncoa2 n/a
7 TRCN0000019642 GCACAGGAAATAGCCATAGTT pLKO.1 1777 CDS 100% 5.625 3.938 N NCOA2 n/a
8 TRCN0000319400 GCACAGGAAATAGCCATAGTT pLKO_005 1777 CDS 100% 5.625 3.938 N NCOA2 n/a
9 TRCN0000096171 CCACACTGAATTTGTCAAGAA pLKO.1 713 CDS 100% 4.950 3.465 N Ncoa2 n/a
10 TRCN0000096172 CCCTTCTGAGTTAGAGATGAA pLKO.1 3242 CDS 100% 4.950 3.465 N Ncoa2 n/a
11 TRCN0000096170 GCCATAGTTATACCAACAGTT pLKO.1 1789 CDS 100% 4.950 3.465 N Ncoa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030252070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.