Transcript: Mouse XM_030253952.1

PREDICTED: Mus musculus predicted gene, 42346 (Gm42346), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gm42346 (105247207)
Length:
1901
CDS:
139..798

Additional Resources:

NCBI RefSeq record:
XM_030253952.1
NBCI Gene record:
Gm42346 (105247207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030253952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086300 CAGGAGAGAAACCTTACAAAT pLKO.1 335 CDS 100% 13.200 6.600 Y Znf41-ps n/a
2 TRCN0000235353 CAGGAGAGAAACCTTACAAAT pLKO_005 335 CDS 100% 13.200 6.600 Y EG666605 n/a
3 TRCN0000240040 ACCTTACAAATGTAGTCAATG pLKO_005 844 3UTR 100% 10.800 5.400 Y Zfp991 n/a
4 TRCN0000418910 ACCTTACAAATGTAGTGAATG pLKO_005 681 CDS 100% 10.800 5.400 Y Rex2 n/a
5 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 682 CDS 100% 13.200 6.600 Y Gm13212 n/a
6 TRCN0000239789 TGTGACAAATGCTTTACTAAA pLKO_005 448 CDS 100% 13.200 6.600 Y Zfp985 n/a
7 TRCN0000084460 CCCATCTTAGTATTCATCATA pLKO.1 725 CDS 100% 5.625 2.813 Y Rex2 n/a
8 TRCN0000421009 ATCCCATCTTAGTATTCATTG pLKO_005 723 CDS 100% 10.800 5.400 Y Rex2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030253952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.