Transcript: Mouse XM_030255118.1

PREDICTED: Mus musculus Rho, GDP dissociation inhibitor (GDI) beta (Arhgdib), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Arhgdib (11857)
Length:
1269
CDS:
195..797

Additional Resources:

NCBI RefSeq record:
XM_030255118.1
NBCI Gene record:
Arhgdib (11857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030255118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106181 CGAGAGTCTAACCAAGTACAA pLKO.1 317 CDS 100% 4.950 6.930 N Arhgdib n/a
2 TRCN0000316511 CGAGAGTCTAACCAAGTACAA pLKO_005 317 CDS 100% 4.950 6.930 N Arhgdib n/a
3 TRCN0000106180 CACACATTTCATCACCAATAT pLKO.1 929 3UTR 100% 13.200 9.240 N Arhgdib n/a
4 TRCN0000316582 CACACATTTCATCACCAATAT pLKO_005 929 3UTR 100% 13.200 9.240 N Arhgdib n/a
5 TRCN0000106182 GACTGGCATGAGAGTGGATAA pLKO.1 584 CDS 100% 10.800 7.560 N Arhgdib n/a
6 TRCN0000316581 GACTGGCATGAGAGTGGATAA pLKO_005 584 CDS 100% 10.800 7.560 N Arhgdib n/a
7 TRCN0000106183 AGTGGATAAAGCCACATTCAT pLKO.1 596 CDS 100% 5.625 3.938 N Arhgdib n/a
8 TRCN0000349171 AGTGGATAAAGCCACATTCAT pLKO_005 596 CDS 100% 5.625 3.938 N Arhgdib n/a
9 TRCN0000106184 GCCATTAAGAAGGATTGGACA pLKO.1 771 CDS 100% 2.640 1.848 N Arhgdib n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 915 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030255118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.